December 24, 2006 - "The End of It"

Dickens put those four words together as the title of the concluding Stave of his "Christmas Carol". And you may indeed wonder how, after the marathon technical textbook of the last 21 days how I might also make "The End of It". But God has also provided, yes, even for this, just as He provides us with the sunrise and sunset...

As we have gone through our 20 meditations pondering the 20 mysteries of the Rosary as well as the 20 amino acids denoted by the triples of mRNA, I have mentioned the "codes" by which each amino acid is indicated. This was the stupendous discovery made by Watson and Crick in the 1950s: the sequence of bases (the letters A, C, G, U) in the mRNA - the "working blueprint" used in building a protein - is "scanned" in triples, and each triple stands for exactly one amino acid. And, since there are four possible bases, and three positions for each base, there must be a total of sixty-four possible codes: ranging from AAA (which stands for Lysine) through CCC for Proline and GGG for Glycine, to UUU for Phenylalanine. The code AUG stands for Methionine, but it is also the special start code which begins the translation from RNA into protein.

Now, if you have been watching very carefully, you may have put all these 20 days of data together into a table, and listed all the names of the twenty...

The amino acids

J2	A	Ala	Alanine
L2	R	Arg	Arginine
S5	N	Asn	Asparagine
S2	D	Asp	Aspartic acid
S1	C	Cys	Cysteine
S3	E	Glu	Glutamic acid
S4	Q	Gln	Glutamine
L3	G	Gly	Glycine
G3	H	His	Histidine
J5	I	Ile	Isoleucine
J4	L	Leu	Leucine
L5	K	Lys	Lysine
J1	M	Met	Methionine
G1	F	Phe	Phenylalanine
G5	P	Pro	Proline
L1	S	Ser	Serine
L4	T	Thr	Threonine
G4	W	Trp	Tryptophan
G2	Y	Tyr	Tyrosine
J3	V	Val	Valine

Or, perhaps you will have collected the various codes together using the traditional alphabetical arrangement:

The Genetic Code

A A A	Lysine	C A A	Glutamine	G A A	Glutamic acid	U A A	?
A A C	Asparagine	C A C	Histidine	G A C	Aspartic acid	U A C	Tyrosine
A A G	Lysine	C A G	Glutamine	G A G	Glutamic acid	U A G	?
A A U	Asparagine	C A U	Histidine	G A U	Aspartic acid	U A U	Tyrosine
A C A	Threonine	C C A	Proline	G C A	Alanine	U C A	Serine
A C C	Threonine	C C C	Proline	G C C	Alanine	U C C	Serine
A C G	Threonine	C C G	Proline	G C G	Alanine	U C G	Serine
A C U	Threonine	C C U	Proline	G C U	Alanine	U C U	Serine
A G A	Arginine	C G A	Arginine	G G A	Glycine	U G A	?
A G C	Serine	C G C	Arginine	G G C	Glycine	U G C	Cysteine
A G G	Arginine	C G G	Arginine	G G G	Glycine	U G G	Tryptophan
A G U	Serine	C G U	Arginine	G G U	Glycine	U G U	Cysteine
A U A	Isoleucine	C U A	Leucine	G U A	Valine	U U A	Leucine
A U C	Isoleucine	C U C	Leucine	G U C	Valine	U U C	Phenylalanine
A U G	Methionine	C U G	Leucine	G U G	Valine	U U G	Leucine
A U U	Isoleucine	C U U	Leucine	G U U	Valine	U U U	Phenylalanine

And you will have discovered that there are three codes which haven't been mentioned. Ah, yes. Here we have an interesting lesson.

Remember the movie "Fantasia" where a young mouse is seen as an apprentice to a wizard? He is told to fetch water (no, it wasn't for a wedding feast this time!) and being a bit lazy, he thought he could get away with invoking his master's magic to assist him by commanding the broom to act as his servant... except that he does not know the word by which he can command the broom to STOP.

In one of the special topics of computing, we call this the "terminating condition": the way in which we "finish" or "complete" a certain kind of task. Astronomers (when they remember, or feel the need to be pedantic) do not say the words "sunrise" or "sunset" but speak of the "morning terminator" or "evening terminator" which mark the bounds of the day and the night...

Yes, this delimiting extends even to the depths of biology. We have already seen that AUG (besides standing for Methionine) marks the start point of translation. The three codes which were not yet mentioned, marked in the above table with a "?", are UAA, UAG, and UGA - the "terminators" of translation. They mark the place where the completed protein is detached from the ribosome (the protein-buiilding machine). It is now free to go about its business, to be useful for the work of the living cell.

In our analogy, we recall that the Rosary also has a special concluding prayer, the "Hail Holy Queen" with its "collect" (from the feast of the Holy Rosary, October 7). This prayer "completes" the larger prayer, and "frees" - not the prayer, but us - to go about our business, and be useful in the life of the Mystical Body.

Let us pray:

O God Who by the life, death, and resurrection of Your only-begotten Son has purchased for us the rewards of eternal life, grant we beseech You, that by meditating upon these mysteries of the Most Holy Rosary of the Blessed Virgin Mary, we may imitate what they contain and obtain what they promise. Through Christ our Lord. Amen.

December 23, 2006 (G5) Proline

Proline - the Coronation of Mary (G5)

December 23, 2006 - (Emnmanuel) - Tomorrow is the Vigil!

Ah, you have come back to learn the solution to the puzzle I mentioned yesterday! Yes, we have considered 19 amino acids and related them to 19 mysteries of the Rosary. But there is one more mystery, perhaps the most mysterious of all.

The mystery called "the Coronation of Mary" is, even more than the Assumption, only vaguely hinted at by any biblical writing. And yet we say that these mysteries are "the Gospel in miniature". How can this be?

The simplest explanation was given by Jesus, when someone in the crowd called out some quip of family-flattery: "Blessed is the womb that bore You, and the breasts that nursed You!" It may not have been meant badly, but it could have easily been misunderstood. So Jesus replied with something which might be even more readily misunderstood: "Rather, blessed are those who hear the word of God and keep it."

This is no contradiction, but a correction. It was not in a physical relation that Mary was Mother-of-God, but in her obedience to the will of God. Yes, this obedience had its completion on Calvary, the offering Jesus made of Himself to the Father - but an offering which Mary had to ratify. But there was another completion, which (because we are created) had its stages. Those stages are the first four Glorious mysteries.

But there was one more stage. And this stage was to involve US, our work, our obedience - that is, our OWN roles in this Great Work. There is no more profoundly perfect representation to be given to this stage than the "event" of Mary's crowning. This crowning, which is the perfect recognition and true completion of her work, clearly cannot be done until her work is complete! Which means, in some sense, this event is NOT in the past - it is only to occur at the end of time. And that is only fitting, for all the subjects of the Queen should be there to pay her homage and rejoice with her as she is crowned - since they (in some sense) ARE her crown.

And so, this mystery is very much of a difference from all the others. Whether it is simply a matter of the "eternal" character which is so much a part of it, or my own speculations, or simply the occurence of G5 after the Assumption (G4), somehow we need to have some strikingly different symbol if we are to propose this mystery in its truly unique setting.

And God, the Master Designer, has given us that most suitable symbol in Proline.



Proline, you see, is NOT an amino acid, though it always ranks as one of the 20 "amino acids" from which proteins are built. Proline is technically an imino acid, because it does not conform to the arrangement of an amide, a carboxylic acid, a hydrogen, and a side chain, all attached to the central (alpha) carbon.

No, in Proline there is a link from the side chain back to the amide. This form is termed an "imino" - it has an -NH- or imide group rather than an -NH₂ amide group. The loop is called a "pyrrolidine ring"; it is not chemically reactive, but its unusual shape changes the larger structure of the protein - Proline "puts a kink" or bend into the protein where it appears.


Proline (abbreviated Pro or P)
RNA Codes:


C C A
C C G
C C C
C C U


Proline has four codes, all of which begin with CC, the third is the "wobble base".

(Every so often I see eighteen-wheel trucks with trailers labelled Proline; I've never seen any of the others.)

So, Proline (the amino acid, er, imino acid, not the trucking company!) has a ring, hinting of the eternal character of the Glorious mysteries. By its being an imino acid, its "side chain" might be considered to contain the nitrogen of its own imide, but that same nitrogen is also part of the underlying structure - this preserves the essentially Marian character, but also hints of a larger topic for meditation, which we may never really grasp until (please God) we come to stand in attendance at the great ceremony, where the good wine will be served...

O Mary, our queen and our mother, pray for us, and guide us to your Son, the Emmanuel.

December 22, 2006 (S5) Asparagine

Asparagine - the Crucifixion (S5)

December 22, 2006 - (Rex Gentium) - Two days to the Vigil!

Today, the last Friday in Advent, we come to Calvary and the mystery of the dying God. As I mentioned earlier in reference to Dickens' "Christmas Carol" we must first understand that Jesus was born, and grew up - that He actually lived - and then grasp the mystery of today: He died - died in a horrible and shameful way, enacted by the conniving of the truth-preserving monotheists and the justice-proclaiming pagans... And the Roman centurion, so skilled in killing, verified the finality of the death with a sword-thrust to the heart; no coroner, no physician, would have quibbled; for the centurion's own life would be forfeit if he had been wrong. Strange echoes sounded then on that hill, that late afternoon in spring: "I too know the meaning of obedience..." Well for us that someone did.

The crib of Bethlehem and the cross on Calvary are not very distant at all: only a few miles (five, perhaps?) and about 33 years (maybe a little less, maybe a little more?)... same wood in each... as a sign to recall the First Sin which involved a tree as well. And it involved food, it involved will - or lack thereof. And so the solution to its puzzle had to involve all those things too, but adjusted, and completed, and restored.

And when the characters in the story have made a royal mess of things, it's up to the author to make the revisions which can bring the story to the conclusion which was originally intended...

The mystery of Calvary, then, is not an end. That guess at its explanation only lasted into the morning of the third day afterwards - at which point it was discovered that the book hadn't finished, because a new chapter - no, a new volume - had begun.

But as we prepare for our own new chapters, let us remember how this chapter came to its completion.

And so today, we come to the last of the amino acids, which, mysteriously, is not the twentieth.



Asparagine (abbreviated Asn or N)
RNA Codes:


A A U
A A C


Asparagine has only two codes, both of which begin with AA, followed by a pyrimidine (C or U), thus splitting the AA codes with Lysine.

Asparagine has a hydrophilic side chain, indicating the Public Life, though it is nonpolar. As Glutamine is derived from Glutamic Acid by substitution of an -NH₂ or amide group for the -OH, so Asparagine is derived from Aspartic Acid. That is, the side chain of Asparagine is the amide derived from acetic acid. The acetic acid hints at the vinegar given to our Lord on the cross; as before, the nitrogen indicates the Marian component, for St. John tells us how he was there beneath the cross with the Mother of Jesus, and heard those words to her: "Woman, behold your son" then to him "behold your mother" - and so the Family began to grow.

This is not simply history any more. This is our Family we're talking about and remembering... it's up to us to live now so as to join our relatives eventually. So much do they look forward to that reunion! Let us do the same.

December 21, 2006 (S4) Glutamine

Glutamine - the Carrying of the Cross (S4)

December 21, 2006 - (Oriens) - Three days to the Vigil!

Today is the winter solstice, the "turning point" for the Earth in the journey around the Sun. I was just thinking how we travel about half a billion miles in one year, which means we go over 60,000 miles an hour, or about 18 miles in a second. Real smooth ride, no?

And the Sun plays its own role in our countdown, as we await the coming of the Sun of Justice, foretold by the Prophets:

O Oriens! O Rising Dawn! Come to us with Your light and Your warmth, lest we die in the cold and the dark! Hurry, and do not delay!

The journey through Advent is nearly complete, as we today we look at that last journey of Jesus. Like Isaac so long ago, He carries the wood up the hill, to the place where God will provide the Sacrifice.

How strange the symmetries to be observed here! There are indeed four amino acids, closely related to each other, which seem to hint at the Mysteries we consider this week. For S4, then, let us choose Glutamine:




Glutamine (abbreviated Gln or Q)
RNA Codes:


C A G
C A A


Glutamine has only two codes, both of which begin with CA, and are followed by a purine (A or G). Note that these mimic the codes for Glutamic Acid, which we saw yesterday, which had a G as the first base.

Glutamine is the "amine" derived from Glutamic Acid. That is, where Glutamic Acid has the -OH (hydroxide, or alcohol) group in the side chain, Glutamine has the -NH₂ or amide group.

The side chain of Glutamine is hydrophilic, suggesting our Lord's Public Life; it contains nitrogen, which suggests a Marian connection. It is not in the Gospels, but remembered in Tradition, and recalled in the Stations, that Jesus met His mother on that journey to Calvary. The Vietnamese give that Fourth Station a deeply touching title: "His Majesty the Lord Jesus, carrying the Holy Cross, meets Her Majesty the Mother". (A pun on the words "cross" and "price" is lost in the translation.) Indeed, for reference, the only Stations of this mystery which appear in the Gospels are First (Pilate's Condemnation), Second (Taking up the Cross), Fifth (Simon the Cyrene) and Eighth (Weeping Women). But who can doubt that He fell, and more than once?

Ah, by the merits of those falls, may God grant us the strength to avoid ever falling into sin!

December 20, 2006 (S3) Glutamic Acid

Glutamic Acid - the Crowning with Thorns (S3)

December 20, 2006 - (Clavis David) - Four days to the Vigil!

Today's mystery recalls how the vicious Romans took some sharp spiny brambles, made them into a cap, then jammed it onto the head of Jesus. Yes, that same head which once lay against His mother. But it was for us that He came! Yes, soon we shall celebrate that coming, and still we look forward in our countdown:

O Clavis David! O Key of David! Come, open your doors for us; lock the gates against our foes. Hurry, and do not delay!

For this second mystery of torture, I use the other of the two amino acids with acidic side chains, called Glutamic Acid, or (because like Aspartic Acid, ionizes in the water of the living cell) also termed Glutamate.



Glutamic Acid - or Glutamate (abbreviated Glu or E)
RNA Codes:


G A A
G A G


Glutamate has only two codes, both of which begin with GA, and are followed by a purine (A or G) - note that yesterday's Aspartic Acid has the other two GA codes - here two very similar side chains share very similar codes.

The side chain of Glutamic Acid is nearly the same as Aspartic Acid - there is merely one additional methyl group -CH₂- which means if the side chain is the three-carbon propanoic acid - another organic acid, similar to acetic acid: sour and smelly, though somewhat weaker chemically as well as heavier.

Is there really any point to consider such details here? No. More horrors, pain, and insults for our suffering Lord.

Let us pray that our actions may never add new thorns to that crown!

December 19, 2006 (S2) Aspartic Acid

December 19, 2006 (S2) Aspartic Acid

Aspartic Acid - the Scourging at the Pillar (S2)

December 19, 2006 - (Radix Jesse) - Five days to the Vigil!

In our mystery today we recall how Jesus was bound to a stone pillar and whipped... yes, that same Jesus, once an infant asleep in the manger. But it was for us that He came! Yes, soon we shall celebrate that coming, and still we look forward in our countdown:

O Radix Jesse! O Root of Jesse! Come, bring Your strength and life, for we trust in Your unfailing power. Hurry, and do not delay!

For this mystery of torture, I use one of the two amino acids with acidic side chains. Don't be confused; remember the common part of the amino acid has a -COOH group, which means it is an acid - though an organic acid, most of which are relatively weak. But each different form of side chain has its own particular properties, as we have seen: some are hydrophobic, some are hydrophilic - and of those, some are neutral, some are "basic" (opposite to an acid) and two are "acidic" since they also contain the -COOH group.

For S2, I have selected Aspartic Acid, frequently termed Aspartate, for it ionizes readily in the water surrounding the proteins in the living cell.



Aspartic Acid - or Aspartate (abbreviated Asp or D)
RNA Codes:


G A C
G A U


Aspartate has only two codes, both of which begin with GA, and are followed byt a pyrimidine (C or U).

The side chain of Aspartate is a well-known chemical -CH₂COOH (there's a hydrogen missing where the side chain gets attached to the central alpha carbon). You probably have some of in your home - in fact, you almost certainly have it in your kitchen! Chemically, it is called acetic acid - or ethanoic acid, since it is the acid form of the two-carbon ethane, and related to ethanol, the alcohol in wine and beer. When acetic acid is mixed with water to about a five percent solution, it is sold as vinegar.

Oh, yes. Indeed, several organic acids are edible; some are quite good when used the right way. But even a sniff will tell you about vinegar - when it was made by hand, people didn't bother to measure, and thus some forms are far more sour than others. Vinegar has been known for thousands of years, as it is really just sour wine, and we shall hear more about it on another day.

But for now, as we ponder the chemistry, let us not lose sight of the wine of Cana (L2) - even while we taste at a distance this sour Roman vinegar of S2, we know that promise of both Christmas and Cana included it.

Therefore, let us pray for light and strength - to reject anything and everything which would sour the good wine Jesus has brought for us!

December 18, 2006 (S1) Cysteine

Cysteine - the Agony in the Garden (S1)

December 18, 2006 - (Adonai) - Six days to the Vigil!

With today, Monday in the Third Week of Advent, we begin our consideration of the last set of mysteries - the Sorrowful, which tell of the events of late Holy Thursday and Good Friday. At first it may appear unusual to be considering such events as we come to the last few days before Christmas - but actually it is very fitting. The Word, the Second Person of the Blessed Trinity, became a man and lived among us for this very purpose: to die! Christmas and the cross are most intimately related, for the Mass which gives the name to our feast is just the unbloody re-presenting of the Cross. But before getting into the details, we must first count off another of the Greater Feria, as in our countdown to Christmas we recall the great titles of our Lord:

O Adonai, Lord of Israel! Come, and give us Your Light by which You guided Abraham and his descendants. Hurry, and do not delay!

As you will recall from the introduction to the Luminous Mysteries, I made selections from among the hydrophilic amino acids to indicate those events which are in the Public Life of our Lord. So, too, the Sorrowful Mysteries will draw from the same selection, with the single exception of today, as you will see in a moment.

Today let us consider S1, the Agony in Gethsemane - the garden of the Olive-Press. There, eleven apostles followed Jesus; eight promptly fell asleep. Peter, James, and John followed Him in a little further, then they too succumbed. Jesus meanwhile began to pray...

What did He pray? He said: "Father not My will but Thine be done."

Haven't we heard that before? It sounded like this: "May it be done unto me according to Thy word."

Ah. You remember. That's J1, the Annunciation, where Mary said Yes to God.

Now it is her Son's turn to say Yes.

To properly emphasize this remarkable parallel, we turn to another of the truly unusual amino acids, the only other one to contain sulfur: Cysteine.



Cysteine (abbreviated Cys or C)
RNA Codes:


U G U
U G C


Cysteine has only two codes, both of which start with UG, followed by a pyrimidine (C or U).

Recall that the side chain of Methionine is an ethyl group
-CH₂CH₂- followed by a sulfur, to which is attached a methyl -CH₃ group. Cysteine is similar, but much simpler. The side chain of Cysteine is a methyl, -CH₂- followed by sulfur with a hydrogen attached.

Unlike the amino acids for the remaining Sorrowful mysteries, this side chain is not truly polar - it is at the border between hydrophilic and hydrophobic. This might suggest the solitude of Jesus in this agony. But far larger is the significance of the sulfur - for the S of S1's Cysteine parallels the S of J1's Methionine - again it is the "Yes" response to the will of God.

But, also like Methionine, there is something more.

Cysteine is very unusual, and it might in some sense stand for the whole of the Sorrowful Mysteries which it introduces. For when Cysteine appears at a certain place in a protein, it has the remarkable ability to be bound to another Cysteine elsewhere, in the same or even in a different protein, forming a disulfide bond between them. This ability of Cysteine to accomplish structure-building by binding separated proteins suggests the entire purpose of Christ's suffering and death: the re-binding of Man to God.

By pondering our lonely Lord in the Garden, may we be strengthened in our resolve to say Yes to the Will of God - now, and always.

December 17, 2006 (G2) Tyrosine

Tyrosine - the Ascension (G2)

December 17, 2006 - (Wisdom) - Seven days to the Vigil!

Today is Gaudete Sunday, the third or Pink Sunday of Advent, and also the first of the Greater Feria, the most childlike of the Advent season wherein Mother Church counts down the remaining days just as the ancient Romans, on whose calendars the numbers went down rather than up. So from now one, we must, as highways do, and synonyms, and IP addresses, and other things both technical and non-technical, double up and write about two things for the same day.

O Wisdom! Come, and give us Your light which is Light from Light! Hurry, do not delay!

Today being Sunday, I again turn to the Glorious Mysteries. The last of these is reserved for special consideration at the proper time, so there is only one remaining: G2, the Ascension. Although it is celebrated on a Thursday, it is a miniature of Easter, which occurred the mystic number of forty days previous. The Lord gives His final instructions, setting up a self-propagating (a living) organism: "Go forth and teach (make disciples of) all nations, baptizing them in the Name of the Father and of the Son and of the Holy Spirit. Teach them to do everything I have commanded you. And know that I am with you always, even to the consummation of the kosmos." [Don't forget that "disciple" comes from the Latin word whichmeans "student" - a follower of a teacher. To have "discipline" is to work as a student does, intent on acquiring whatever the Teacher has to offer.]

When He had finished these bnrief instructions, He blessed them. And then He was lifted up... but they were joyful, and went back to Jerusalem to pray, and wait as He had told them earlier. And in nine days, the Spirit came, giving gifts, among which was Wisdom... (see above!)

Just as I have almost run out of Glorious Mysteries, so have I almost run out of amino acids with rings in their side chains - ah, but there is one more left. (Yes, as you will see, the one other remaining is already allocated to G5, but if you already know what that is, please don't give it away!)

For G2, then, let us consider Tyrosine:



Tyrosine (abbreviated Tyr or Y)
RNA Codes:


U A C
U A U


Tyrosine only has two codes, both of which begin with UA, and are followed by a pyrimidine (C or U).

The side chain for Tyrosine is a methyl (like Alanine of J2) but with one hydrogen replaced with a benzene ring, as in Phenylalanine of G1) - but the para position of that benzene has had its hydrogen removed and substituted with an -OH (hydroxide, or alcohol) group. Thus, Tyrosine is just the alcohol version of Phenylalanine.

This close similarity hints at the very close relation between G1 and G2. Both are utterly supernatural - a man rises from the dead; a man ascends to heaven! The ring character of both Phenylalanine and Tyrosine is not similar to the other amino acids with rings in their side-chains; indeed, the other three are all remarkably distinct: Histidine with a pentagon containing nitrogen; Tryptophan with a two-ring structure; and - ah - another to be discussed soon. (Not long now!)

Even more remarkably, where Phenylalanine is hydrophobic, the -OH group means that Tyrosine is hydrophilic. While in most cases I use that property to suggest the "Public Life", in this case it suggests the command of our Lord to baptize all nations... Rather than complicate my discussion of Histidine (G3) at the very beginning, I neglected to mention that it too is hydrophilic, symbolizing the baptism of the 3,000 who were added on the day of Pentecost.

Let us, then, today thank God for sending forth His apostles to spread the good news: Christmas and Passion and Easter, and the baptism which gives the shape of the New Life where we share in those mysteries! And remember, too, that we are now bound to do the same: "their message goes out to all the earth" [See Ps 19(18)]

December 16, 2006 (L5) Lysine

Lysine - the Institution of the Holy Eucharist (L5)

December 16, 2006

Today we complete our examination of the Luminous Mysteries with L5, in which we visit the Institution of the Holy Eucharist. At the Last Supper, Jesus fufilled the ancient prophecies and the even more ancient forms of contractual covenant and sacrifice: the victim which was offered and slain was eaten. Once in Egypt, the blood of a lamb, ritually sacrificed and eaten, marked out those contracted for life. Now, even as the Full Moon of Spring brings around the Old Rites, a New and Unblemished Lamb would be ritually slain, and also consumed.

(From the extreme antiquity we hear an echo - a young lad says to his father as they ascended the hill: "Everything is here, Father, but where is the sacrifice?" to which the father replied "God will provide.")

Yes, considered merely as symbol, this new offering was strong and correct - but it was also real, legal, and as official as anything can ever be. Yes, far more was the reality of this New Sacrifice, this New Covenant, which would also contract its participants for Life - but which would also accomplish a NEW binding together in the most fully legal and contractual sense - the binding which we shall see when we consider S5.

But this last of the Luminous is also the last of the "Mysteries of Water" - and so we turn again to our rapidly dwindling store of unused amino acids, and propose Lysine for our consideration.



Lysine (abbreviated Lys or L)
RNA Codes:


A A A
A A G


Lysine has only two codes, both of which begin with AA, and are followed by a purine (A or G).

The side chain of Lysine is a straight four-carbon chain (butane) to which an -NH₂ amine group is appended. Two other amino acids have a four-carbon side chain: Leucine (J4) and Isoleucine (J5). So here we have echoed the Presentation in the Temple (the Eucharist is indeed solemnly offered to the Eternal Father just after the consecration!) and the Finding in the Temple ("I must be about My Father's business"; this is echoed at the very end of the book of Revelation by Jesus Himself: "Behold I make all things new".)

This side chain is also similar to Arginine; it may be argued that the Biblical narratives of the Last Supper do not indicate that Mary was even nearby. But it is a mystical tradition that she received Her Son at that time - and so the Marian token of the nitrogen in the side chain is not unsuitable. It is indeed that amine group which gives Lysine its hydrophilic and "basic" character ("basic" is meant here in terms of pH).

Now, having mentioned this hydrophilic character of the amino acid, I must turn to the somewhat more mysterious way in which water enters into this mystery. If you are attentive at Mass, you will remember that the priest adds just a drop of water to the wine at the Offertory. He says this prayer:

By the mingling of this water and wine, may we come to share in the divinity of Christ Who humbled Himself to share in our humanity.

So we know that water enters into the wine, even if we omit the rather obvious fact that wine is itself mostly water in the physical and chemical sense.

But what about the bread?

Well, the special kind of bread which is used in the Mass is called unleavened - which means it has no leaven, or rising agent: no yeast nor eggs, nor baking soda, nor butter or other fat which could give it thickness. In fact, the bread for the Eucharist contains exactly two ingredients: wheat flour and water. It is mixed, and baked. Very simple. Ah, that's where the water comes in.

Let us, then, the next time at Mass when we say that famous prayer of a pagan soldier, think how the humble water has vanished: lost in the chalice of wine, evaporated in the baking of the bread... and so long ago did the baptismal water dry from our foreheads! But without that hidden, humble, secret water in all three of these cases, there would be no Eucharist for us [for only the baptised may partake]... Oh Lord I am NOT worthy that You should come under my roof. But only say the word - and my soul shall be healed. Father, may that baptismal water give me the "right shape" and so conform me to Your Word. Amen.

Ah, yes, I almost forgot to mention the connection to our preparation for Christmas. Indeed, there is one. The prayer I quoted above, which is said as the water is mingled with the wine, is actually derived from an old "Collect" (opening prayer) for Christmas, hinting as it does of the Hypostatic Union: Jesus Christ, True God and True Man. To Him be praise and glory through unending ages. Amen.

December 15, 2006 (L4) Threonine

Threonine - the Transfiguration (L4)

December 15, 2006

The Transfiguration is, far more than any of the others, a Mystery of Light. A whole book could be written on the scientific character in this mystery - on light, on the many things we have learned about it, on its strange dual "wave/particle" nature, on its superlative speed, on its unchanging qualities, on its relation to matter and to energy (expressed in the famous E = m c², of course!). So much more... and here, a human being is luminous...

It is said that this view or glimpse of the Divine veiled in the humanity of Jesus - shall we call it a private epiphany - was granted to Peter, James, and John, in order to strengthen them for the coming Passion. It was about that Passion that Elijah and Moses came to witness, that the Law and the Prophets of the Old Covenant might be seen together with three representatives of the New Covenant. (Yes, the requirement of two or three witnesses (Mt 18:16) should leap to mind; here we have both two and three!)

But where, you ask, is the water? It's subtle - as well as Chestertonian. Both Matthew and Mark mention how the garments of Jesus became "as white as snow"... but snow, you may know, is not white! It is (as GKC says somewhere) a "transcendental colour" - no, he does not use the word as a mathematician! Snow is clear, but also reflective. Its "colour" is really that of its light source. In this case, then, we feel "the presence" of Mary, though she is not on the scene at all. Why? Remember what St. Francis wrote about water?

Praised be my Lord for our sister water, who is very serviceable to us, and humble and precious and clean. [from the Poetry Appendix in the Liturgy of the Hours]

This is another example of the humble character of water, which never shows its own color but is always reflective of the source of its light. (The main way in which water is humble is almost a pun: it always seeks the lowest place.)

With this watery character in mind, then, we turn to the remaining amino acids with hydrophilic side chains. Since I used Serine for L1, which was a great epiphany, I will use a close relative: Threonine.



Threonine (abbreviated Thr or T)
RNA Codes:


A C G
A C C
A C U
A C A


Threonine has four codes, each of which starts with AC (and then the usual wobble base).

(A humourous aside: the name of this amino acid may recall one of the "car" songs of the Beach Boys, though theirs was Fouronine.)

The side chain is the same as Serine, but with a methyl -CH₃ substituted for one of its hydrogens. Thus the side chain is ethyl alcohol with one hydrogen removed. At one point I considered Threonine for L2, to associate with the wine, but the Marian indication of the the nitrogens of Arginine seemed more fitting. Both Serine (L1) and Threonine have the -OH (hydroxide, or for organics, alcohol) group. In certain enzymes, the -OH of Serine provides a reactive site, but this is not the case with Threonine. (This suggests the more public character of L1 versus the private character of L4.)

One observation I have pondered in my own consideration of L4 is the words of St. Peter. He suggests the building of three (no pun intended) tents, and states, "Lord it is good for us to be here." To me, this hints that perhaps L4 was somewhat more than a simple revelation of Jesus the God-Man - or, perhaps I should say L4 also reveals the direct result of being with Jesus Glorified. What I am trying to say is this: as Jesus revealed Himself as True God and True Man, the essential quality of His presence, which IS heaven, was also sensible in some manner. Hence, immediately Peter acknowledges that it is "good to be here" - that is, here, with Jesus - and so he thought to make arrangements to maintain that life. I wonder if any of them thought of this when after the Last Supper Jesus told them about the "many dwelling-places" in His Father's house...

Let us pray that we may have True Light and so come to live where "it is good for us to be"...

December 14, 2006 (L3) Glycine

Glycine - the Proclamation of the Kingdom (L3)

December 14, 2006

This mystery has a most unusual character. In fact, it is the only mystery which is just about a "wild card" - that is, one can consider just about any event or action in the life of Jesus from just after Cana until the Transfiguration (which is a kind of prelude to the Passion and Holy Week, regardless of its precise chronological position). Some people seem to focus on the Sermon on the Mount; but there is nothing to prevent considering a parable, or any of the numerous healings, or the multiplication of loaves and fishes, or the walking on the water - or the stilling of the storm - or the instruction on the Eucharist - or the debates with the Pharisees, and lawyers, and Sadducees - or the cleansing of the Temple... Just about anything from perhaps 3/4 of the Gospels can fit here.

There is an amino acid which, in a strange sense, is just like that. It is hard to characterize simply, if at all - because it is very simple. It is the smallest and lightest - its side chain is just one hydrogen atom.



Glycine (abbreviated Gly or G)
RNA Codes:


G G A
G G G
G G U
G G C


Glycine has four codes, all of which begin with GG (it has a wobble base in the third place). Even though Glycine is classed as non-polar (hydrophobic) I have selected it for L3 because of its remarkably simple characterization.

You will recall that I said the Luminous Mysteries might also be called "The Mysteries of Water". While clearly not every evet of the Public Life of our Lord has such a connotation, there are enough that a list is easy to give:
1. the calming of the storm
2. the walking on the water (and Peter, too)
3. the calling of the pairs of fishermen-brothers as apostles
4. preaching from the boat
5. the miraculous catches of fish - Peter: "depart from me O Lord, I am a sinful man")
6. the "neighborhood of Caesarea Philippi" - Jaki's And On This Rock explains that this is one of the sources of the Jordan River
7. the Samaritan woman at the well: "If you knew Who was asking, you would ask Him to give you living water"
8. "anyone who gives so much as a cup of cold water in My Name to a disciple..."
9. "Go and wash in the pool of Siloam"
10. the Rich Man: "tell Lazarus to bring me just a drop of water"

That's a decade's worth right there, and that is without consulting a concordance. How often the Jordan is in view, or an issue about purifying (washing hands, etc) or some tangential hint of the amazing fluid of life...

Yes, there are others, too - but they come into other mysteries. There is a unity here, which one would expect from the same Designer Who gave us these hydrophobic and hydrophilic amino acids!!!

December 13, 2006 (L2) Arginine

Arginine - the Wedding Feast at Cana (L2)

December 13, 2006

Today's mystery, as yesterday's, is one of the "epiphanies" - the showing forth of the divine power of our Lord. In the Office for the feast of the Epiphany (traditionally January 6) both L1 and L2 are also recalled as a mystic trinity of relevations at different levels... there is very much to be said about this, as it touches on what Chesterton calls "God's literary style" and perhaps someday someone will write about that. But not me, not here, and not now. I have far too little time tonight, and I am already late.

This mystery is the only non-Joyful mystery in which we hear Mary - indeed, in L2 we hear her very last recorded words. Not, of course, that she never spoke again! But none of those words were recorded for us by any evangelist.

In order to emphasize this dramatic character, in a drama which her role transcended any guess as to the impact a human can have on God, I have selected Arginine.



Arginine (abbreviated Arg or R)
RNA Codes:


C G U
C G G
C G C
C G A
A G A
A G G


Like Leucine (J4) and Serine (L1), Arginine has six codes: any of the four beginning with CG (and the wobble base), and the two starting with AG, followed by a purine (A or G) - the other two AG codes are used by Serine, as you may recall.

Arginine is hydrophilic, and "the most basic" amino acid - that is, in terms of its pH. It is the only amino acid to have three nitrogens in its side chain - which urged me to select it to stand for Mary's bold, but completely motherly and perfectly respectful words. After she had told Jesus that the wine had run out, and He had said, in an almost casual manner, "Mother dear, does it matter just now? My time has not yet come."

She does not argue. She lets it up to Him. She just says: "Do whatever he tells you."

Yes, this is the most basic of all instructions we have, from His own mother's mouth. And if we DO do whatever He tells us, why - then, without fail, we shall also hear those other words, better by far than even GKC's hints and paraphrases of them, and better even than those words of the parable about "the good and faithful servant".

We shall hear this:

"But you have kept the good wine until now."

It's up to us. Are we going to ignore Him, and bring the wedding-feast to ruin?

Or will we hear His words, as silly and inconsequential as they may sound - and do the little task He instructs us to perform (just fill up those six jugs with water... WATER - I told you these were the Mysteries of Water!) and behold, the new and far better wine, which is drunk in the Great Wedding Feast which never ends.

December 12, 2006 (L1) Serine

Serine - the Baptism in the Jordan (L1)

December 12, 2006

Today in the Western Hemisphere is the great feast of our Lady of Guadalupe - the first appearance of Mary in the New World, not quite 40 years after its discovery. It seems somehow fitting that today I turn to the Luminous Mysteries, which (since their proposal by John Paul II in 2002) are a kind of "new world" of meditation for those who say the Rosary. These five new mysteries examine the "Public Life" of our Lord, the stories of which comprise by far the largest portion of the Gospels.

And, as I took the "ring-structures" of certain amino acids to represent the "other side" of the Glorious Mysteries, and the "hydrophobic" stay-together side-chains of certain other amino acids to represent the closely related character of the Joyfuls, I must now set forth the poetic design I have arranged for the other ten. Two of these have already been assigned based on other considerations, and if you are keeping track (because you have a chart of the 20 amino acids) you will immediately see that there is a set of exactly eight amino acids with one common property: they all have side-chains which are hydrophilic - that is, water-loving. These like to associate with the ubiquitous water of the living cell, and stay "outward" where those with hydrophobic side-chains stay "inward". This hydrophilic character, then, reflects the "outward" character of these Mysteries of the Public Life of Jesus.

In fact, while John Paul used the term "Luminous" for the five new mysteries of the Public Life before the Passion, one might almost as easily use the term "Hydrophilic" or "The Mysteries of Water" - since this common, critical, marvelous substance plays an important (and sometimes dramatic) role in all five of them. Elsewhere (see the index at right) I have written some thoughts about the amazing properties of water; here I should recall the famous words of St. Francies from his "Canticle of the Creatures":

Praised be my Lord for our sister water, who is very serviceable to us, and humble and precious and clean.
[from the Poetry Appendix in the Liturgy of the Hours]

Bear these in mind, then, for they provide many clues to matters which I can only hint at now.

So, let us proceed with today's mystery, the Baptism in the Jordan, to which I have associated the amino acid called Serine.



Serine (abbreviated Ser or S)
RNA Codes:

A G U
A G C
U C G
U C U
U C C
U C A


Like Leucine and one other, Serine has six codes. Four are those which begin UC, followed by the "wobble base". The other two begin with AG, followed by either pyrimidine (U or C).

Serine is the first of the amino acids we have explored to have an oxygen in its side-chain - there are six others to come. Its side chain is the simple -CH₂OH which is a methyl alcohol group. You might wish to compare it to Alanine (J2) which uses the -CH₃ methyl group; its simplicity hints at the starting point of the public ministry.

The Baptism of Jesus has its own separate feast day, but in the liturgy it is tied together with the Epiphany (which also has its own feast day) and with the Wedding at Cana (which has no feast but does have a mystery, L2, to be considered tomorrow). The common note of these three is "epiphany" in its lower-case sense - that is, a showing or a revealing of the divinity of Christ. Here, the revleaing is the testimony of John, the voice from the sky, and the appearance of the dove, which once announced the ending of the Flood. Now a different announcement is made, which we still hear at every Mass: "Behold the Lamb of God, behold Him Who takes away the sins of the kosmos."(see Jn 1:29) But there is much more here than just a washing, or purification, no matter how severe the pollution. There is a re-newing of life.

In the mystery of the Baptism, the water which "washes" Jesus is itself purified - but it is given a new and mystical power. Deep, deep, is this mystery, tied so dramatically to our very topic here! Massive volumes of study, representing centuries of research, have pondered how the proteins of life take their shapes - and the single great answer to be seen on every page is WATER. Yes, there are other properties which give rise to protein structure; we shall hear more about one eventually. But consider the great division of the classes of amino acids: hydrophilic and hydrophobic! At every point in the protein, one must consider: does this amino acid there avoid the water, or mingle in the water? For this is the primary determinant in its shape.

Yes, in Biology, water is the basis of natural life. So, because of this Mystery, water is now also the basis of supernatural Life. The shapes of the proteins are important, an error in specification can be determined down to a precision of atoms. The precision of this new Life is likewise measured: for Jesus said "Not the smallest letter, or even part of a letter of the Law shall pass away..." And this Life is brought about by means of water. We renew, and re-affirm, our own baptism at the Easter ceremonies, and most dramatically recalled by the blessing of the water at the Vigil.

Let us then fervently (which means boiling!) renew our baptismal vows as we recite this mystery, and then ponder our baptism as a beginning of new Life, a life in Water and the Spirit. It is the same simple, natural, wonderful water which once poured over Jesus Himself, and which dictates the shapes of our inmost physical being - and which now raises our sight to our proper place - a place in a far greater Structure, "built upon the foundation of the apostles"... (See Eph 2:19-20) Ah, yes - and there is so much more to say about this; St. Paul might truly be called the first biologist of Supernatural Life! But for now, it is better to think, and pray.

December 11, 2006 (J5) Isoleucine

Isoleucine - the Finding in the Temple (J5)

December 11, 2006

With today's posting, we complete our examination of the Joyful Mysteries. Recall that I have been making an analogy from them to the hydrophobic amino acids - which (if you have been following your own amino acid list) means that I don't have a lot of choices left. But if you consider the amino acids for J2 (Alanine) and J3 (Valine) and J4 (Leucine) it should be rather obvious that J5 should be Isoleucine.



Isoleucine (abbreviated Ile or I)
RNA Codes:


A U U
A U C
A U A


Isoleucine is rather odd, as it has three possible codes. It almost seems as if (like Alanine or Valine) it has a "wobble base" in the third position, as all three start with AU. But which code starting with AU is not used? Ah - it's our old familiar "AUG" - which we remember is both the starting signal, and also the code for Methionine (which we used for J1).

This amino acid always makes me laugh, because I'm always expecting a comedy chemist to make a joke about "I love Lucy-ne". After all, can Lucy be far behind if C₂H₅- is called "Ethyl"? (Hee hee)

Ahem. If you compare Isoleucine to Leucine, you will find they are VERY similar. In fact, this is what chemists call an isomer - the chemical has the same quantities of elements, but the relations between them (the bonding) is different. In today's amino acid, the side chain would be called "sec-butyl" in other compounds.

This very strong - familial? - resemblance between Leucine and Isoleucine parallels the strong relation between J4 and J5. In J5, the Finding of Jesus in the Temple, we see Jesus, Mary and Joseph in the Temple - just as we saw them in J4. In both cases, the pivotal issue - the drama - is that Jesus is given over to God. In J4, Mary and Joseph present Him, but offer (in a kind of mystical trade) the prescribed sacrifice. In J5, Jesus is now 12 years old, probably (after the Bar Mitzvah?) considered a young adult - and He seems to "offer" Himself - so one might explain that strange statement to His parents: "I must be in My Father's house, about My Father's business."

And yet He returns with them and stays with them in Nazareth another eighteen years...

Somehow in the terse dialog, so poignant, and yet so uplifting, there is an echo of another line which we shall hear very soon when we examine L2: "My time has not yet come." Yes, in J5, as in L2, the time had not yet come. But He would return to the Temple - to His Father's house - soon enough.

May we long to be in our Father's house, and ask Jesus, Mary, and Joseph to guide us to our Home!

December 10, 2006 (G1) Phenylalanine

Phenylalanine - the Resurrection (G1)

December 10, 2006

As you will have seen in the previous seven days, I use the various - even dramatic - differences between the 20 amino acids to give hints at the 20 Mysteries of the Rosary. I selected the five amino acids which have "rings" in their side chains to signify the five Glorious Mysteries. Just as the endless circle of the wedding ring signifies the unending love of the married couple, here the various "aromatic" rings of carbon (and nitrogen) hint at the "unending" character of these mysteries which are "on the other side" of our Lord's death.

Today is the second Sunday of Advent, and so we consider one of the Glorious Mysteries. We've already seen G3 and G4, and G5 has its own special place; so we only need to divide G1 and G2 between today and next Sunday. Just as each Friday we recall the death of our Lord, each Sunday is a "little Easter"; so today let us consider G1, the Resurrection, for which I have chosen Phenylalanine.



Phenylalanine (abbreviated Phe or F)
RNA Codes:


U U C
U U U


There are only two codes for this amino acid; the two which begin with UU and are followed by a pyrimidine (C or U). (Yes, this is the "buddy" to Leucine's codes we saw yesterday.)

There are strikingly beautiful symmetries to be seen here. Remember that J2, the Visitation, was represented by Alanine, with its simple CH₃- (methyl) group? Here, we see the very same methyl, but one of the hydrogens has been replaced by the strange and wonderful six-carbon benzene ring. (Chesterton would be delighted in the paradox whereby a jewel is ornamented with a ring!)

And, perhaps even more than our pun linking Tryptophan with the Dormition of Mary (G4), the appearance of the benzene ring in G1 conveys the idea of a surprise awakening in the early morning.

The story is told that the organic chemist Kekulé was struggling to determine the chemical structure of benzene, known to have the composition C₆H₆. One night he had a dream (or nightmare) of a snake biting its tail. He awoke and drew the famous hexagon with the alternating single and double bonds which you can see in the above diagram! Six C's and six H's, each atom perfectly satisfied with its arrangements.

But this compound, in fact, is 1,3,5 cyclohexatriene. But if you rotate the diagram 60 degrees, you get 2,4,6 cyclohexatriene. (You have to use a trick to keep the number one carbon staying number one.) Is that really benzene, then, or is it something else?

Ah. As even newborn organic chemists will tell you, this single/double hexagon is a symbol of something rather more complicated. For the six carbons share their bonding electrons within the ring, and the single-ness vs. double-ness does not normally appear at all - one might say that all six of the carbon-to-carbon bonds are "1.5" - halfway between single and double - though that is also almost a mystical idea. (Yes, under certain conditions, however, one can force the double-bonds to be permanent, but I cannot go into that now.) So the diagram is just a sybolic convention to denote a greater reality. As a hint of this truth, they will draw a circle within the hexagon, omitting the double-bonds.

In some ways, all this technical lore of organic chemistry has a louder echo in the mystery - the supreme mystery of all time - the Resurrection - where Jesus came back from death. Does this relate at all to Advent? Sure. One of the greatest of all Christmas stories, after the Gospel itself, is the powerfully inspiring "A Christmas Carol" by Dickens. As we shall see when we discuss S5, Dickens begins with a phrase which we must ponder again and again, if we hope to have any understanding at all of what this mystery is about:

Marley was dead: to begin with. There is no doubt whatever about that. ... There is no doubt that Marley was dead. This must be distinctly understood, or nothing wonderful can come of the story I am going to relate.

Oh, yes. How much more, then, must we understand, as Jesus Himself told the two on the way to Emmaus, that late afternoon on a Sunday in Spring... (see Luke 24:25-27) How much more must we understand that His death was real, and terrible, and complete - legally certified, too, as we shall hear - but this death was not the end.

It was the beginning.

Which means we also must have hope - it's the real meaning of Christmas hope, too: not presents, not cosy homes, not even family - but our true Family, our long-awaited Home, and the Perfect Presence.

Yes, even Kekulé would agree that such links binding Christmas and Easter are far more complex than even a snake dream might inspire. Then again, it's just what God promised the snake in the garden, isn't it? Hee hee.

December 09, 2006 (J4) Leucine

Leucine - the Presentation (J4)

December 09, 2006

As we come to the end of the first week of Advent, we are nearly finished with the Joyful Mysteries. Today we remember how, in accordance with the Law, Mary and Joseph brought Jesus to the Temple, to offer Him as the Firstborn. How strange it is when we read that He, Jesus the God-Man, Whose Name means "God saves" was Himself redeemed with a pair of turtle-doves or two young pigeons! But it was done. And in this mystery, we are given the third of the great Gospel Canticles, the "Nunc Dimittis" of Simeon, the dear confident lullaby which the Church sings at Her bedtime (though most call it Night Prayer, or Compline). Yes, that reminds me I neglected to mention that the other two great Canticles, the gates of Morning (the Benedictus of Zacharias) and of Evening (the Magnificat of Mary) are pondered in J2 (the Visitation). But I have already told you about the "strongly connected" character of the Church!

So we already have one connection between today's J4 and another Joyful (J2). But then all the Joyfuls are to a degree "hidden" mysteries - the young Jesus is known or seen only by a very few. This common trait of these "hidden" mysteries is, in my series, matched by the hydrophobic character of certain amino acids, which tend to keep their side-chains with like amino acids and awy from the surrounding water of the living cell. There being only two more to choose from, and two which are very similar to each other, I let that commonality work to my advantage, though I will defer a fuller discussion until Monday when we shall see J5 and we shall then see more into Leucine and its relation to J4.



Leucine (abbreviated Leu or L)
RNA Codes:


C U G
C U U
C U A
C U C
U U A
U U G


This amino acid has six codes: any of the four which start with CU, and two which start with UU followed by a purine (A or G).


The side chain of Leucine looks as if we took a methyl group -CH₂- and stuck the side chain of Valine (J3) onto the central (alpha) carbon - thus suggesting the very close relation in time between J3 and J4. In other componds, this side chain is called "isobutyl".

When I considered J3's Valine, I nodded to its three carbons and seven hydrogens; here one might see another, more unsettling symbolism: for the Y-shaped side chain of Leucine gives the hint of the Cross (S5) where the offering made in J4 was accomplished - and accepted, on behalf of Adam the Firstborn and his descendents. In S5 then, as in J4, the Firstborn was indeed Redeemed.

Yes, even Valine has that cruciform character, and it will be more clearly understood in this context. In "The God in the Cave", GKC's profound meditation on the Nativity, he writes:

For those who think the idea of the Crusade is one that spoils the idea of the Cross, we can only say that for them the idea of the Cross is spoiled; the idea of the Cross is spoiled quite literally in the Cradle.
[GKC, The Everlasting Man CW2:314]

We need to emphasize again and again that these mysteries are deeply, intimately, wonderfully connected! It's why we celebrate Holy Mass (the re-presenting of Christ's Death) on Christmas, and why even on Holy Thurday at 6PM, with scant hours before we commemorate that Death, we are saying the Angelus prayer of the Incarnation (J1).

Somehow all this is also hinted at in the chemistry of life - to paraphrase St. Paul, there are many amino acids, but the same carbon. The same DNA directs the formation of the multitudinous components of the machinery of life. Let us then be as single-purposed, dedicated to doing the varied tasks which accomplish work of the Life of the Spirit.

the ACS blogg game

December 8 is also the anniversary of the beginning of the ACS blogg, and before I have my dinner on the roof (or ceiling) I will play the game.

1. When did you first read a Chesterton book, story, or poem, and which was it?
I first heard my father recite "Lepanto" when I was about 4 or 5. If I recall correctly, my first complete GKC book was "The Fatber Brown Omnibus" probably in 7th or 8th grade, since in 9th or 10th we read "The Invisible Man" but I already knew it. Curiosity about "Lepanto" during a boring part of my master's work led me to the renowned Return To Tradition anthology (which includes "Lepanto" and excerpts from several books), which led me to begin an omnivorous and insatiable desire to read GKC. Twenty years later I am still busy...

2. What was the most recent of GKC's writings you read?
Er... the last complete reading of GKC was Nancy Brown's study guide to "The Blue Cross". But with the work I do, my dipping has begun to approach a continuum: when I am near AMBER or its tactile equivalent, I am attracted, and go forth with an increased charge. Hee hee. Or, to vary the metaphor, Gilbert is quite magnetic.

3. Which is your favorite book, poem - or quote?
Wow, hard. My favourite is usually the last one (book, poem, or quote) that I read. But I have to single out for mention The Everlasting Man which is without doubt the most important book I will ever see in my life (after the Bible). Elsewhere I have gone on record as saying my favourite quote is near the centre of that book, and it is the e ... - er, call it the "paragraph break" after this sentence: "There was no God; if there had been a God, surely this was the very moment when He would have moved and saved the world." (In automata theory, e is the string of zero length, the identity of the free monoid; but I am sure you already knew that. Amazing the technology one finds in GKC.)

4. Which would you recommend to a beginner?
I cheat, and give them 12 at once with Dale Ahlquist's The Apostle of Common Sense, or else the "Chesterton University Student Handbook" which has a nice handful of quotes from lots of books.

5. What is the most unusual fact or quirky detail you know about G.K.Chesterton?
You mean Doctor Chesterton? He also had a Ph.D. though it was honorary! The most unusual fact about him was that one day (in either 2000 or 2001) I was standing in the computer room at my previous employment, and a co-worker walked up to me and said, "Doc, I want you to meet Mr. Chesterton." There behind him was a vast-sized man, yes, really named Chesterton, who was actually a distant cousin of GKC; he worked for a customer of ours. (I think half the company was crowded around to see my reaction, which was as you might guess - a look of shock and awe!)

December 08, 2006 (G4) Tryptophan

Tryptophan - the Assumption (G4)

December 08, 2006

We interrupt our Advent for a Solemnity: the feast of the Immaculate Conception. Today, nine months before the birthday of Mary, we celebrate that moment when, in the natural marital act between Joachim and Anna, at the moment of the creation of Mary, God (by foreknowledge of the Redemptive Act of the Son) preserved her free from the sin all men inherit from Adam.

This was the great announcement-bell that was rung, proclaiming that the new creation had begun. It was a "window-opening moment", dividing time, as Noah flung open the window on the flood... there would be a culmination at the Baptism in the Jordan, when the dove would again be seen above the waters.

But the mystery of this feast, so great, so Christ-centered, is not to be found among of the mysteries of the Rosary. So what's a poor tech writer like me to do? Obviously, use a "figure of speech" - a metonymy - and take the next closest as a representative.

Which mystery is that? Clearly it must be a Glorious mystery, since today is a solemnity. It should somehow be "hidden" as was the Immaculate Conception: a real historical event, yet not literally recorded as such in the Bible. Hence, let us consider G4, the Assumption - the "bookend" feast which is the direct result of today's feast. Our Eastern brothers call that mystery the "Dormition", and it may almost sound like a chemical joke to select Tryptophan as its representative. But as I mentioned previously, I had already chosen to use the "ring" side-chains to represent the Glorious Mysteries, and the appearance of the nitrogen in the ring suggests a specially Marian connection.

(Nor could I select the last Glorious, which has its own special and most dramatic representation, as you shall see.)



Tryptophan (abbreviated Trp or W)
RNA Codes:


U G G


Yes, like Methionine, there is only one code for Tryptophan.

Tryptophan is perhaps the only amino acid to be well-known because of its so-called "turkey-sleep" properties. Like methionine, it is not of frequent use in proteins. It has the largest of the side-chains: a methyl group -CH₂- connects to a double ring, one with a nitrogen. The side chain has a total of 9 carbons, 1 nitrogen, and 8 hydrogens.

Tryptophan is hydrophobic, and will try to stay clustered with other such amino acids, away from the surrounding water of the living cell. This suggests a strong relation of G4 to the Joyful mysteries - Mary seems to be the prominent character and yet her Son, true God and true Man, here hidden even more than in any of the Joyfuls, is seen to be In Act (see Mark 16:20), for "only God can raise the dead" (cf. John 5:21). Note we do not say that Mary "ascended" (which would mean she did it herself) - but that she was "assumed" which means "taken up" (what an elevator does for us) by the divine power of her Son! This privilege was merited by her divine maternity, and in particular by her deathless martyrdom at Calvary, and so is closely tied to today's mystery as well.

G4 can be one of the hardest mysteries to ponder because of its extreme hidden qualities. At first, this seems reasonable, because we are confronted with the idea of Mary's sinlessness. But we have overlooked something, or rather two things. First, we're going to have to be sinless in some sense if we're going to get into heaven. Since most of us do sin, and even frequently, this is what Confession is for. We can get another try at it - and it's far better than even the "Groundhog Day" kind of re-try, because it's real. Second, we ARE going to be "taken up" just as Mary was, at the end of time. So far from being a "distant" or near-irrelevant mystery, this is more like an advertisement for going to heaven! You know: "It's up to you: Mary did it, and so can you." No, we're not going to get the chance to stand at the foot of the Cross, or escape to Egypt, or hurry about Jerusalem looking for Jesus, or ask about running out of wine at a wedding-feast. But there are lots of little things we can do which can witness to Jesus, defend Him, seek greater knowledge of Him, and be of service to others through Him... It's up to us if we want to follow her as she followed Him.

Today, let us remember her last recorded words, the words which are her hallmark and her life: "Do whatever He tells you."

December 07, 2006 (J3) Valine

Valine - the Nativity (J3)

December 07, 2006

One of the clearest indications to me, a computer scientist, of the superlative designs in our Faith is the extreme degree of interconnectedness between its parts. In graph theory (a field within computer science, shared with mathematics) there is a term: we say a graph is strongly connected when there are at least two paths from any location to another within the graph. This is perhaps just a tech way of saying (as we do in the Creed) that the Church is "one, holy, Catholic, and apostolic".

For example: prayer is "strongly connected". Sooner or later, at Holy Mass we will hear the Gospel where the disciples ask our Lord how to pray - and He teaches them the "Our Father"... but then we also say it later on in that Mass (and in every Mass).

Or, when we are praying the Second Glorious mystery (G2) of the Rosary, meditating on the Ascension: as part of His farewell command, Jesus tells them to baptize all nations "in the name of the Father and of the Son and of the Holy Spirit"... but no doubt we blessed ourselves with those very words as we began our prayers, and will conclude the decade by saying the Glory Be, which again names the Three-In-One.

Here, too, you see, even during our Advent preparations for the Nativity, we spend time pondering the Nativity itself!

And since in considering the Nativity today, we are considering one of the Joyful mysteries, we explore an amino acid with one of the hydrophobic side-chains - Valine.



Valine (abbreviated Val or V)
RNA Codes:

G U A
G U G
G U C
G U U

The side chain of Valine is the isopropyl (CH₃)₂CH- with a total of three carbons and seven hydrogens. Again we see an amino acid for which the third base (the so-called "wobble" base) of the triple, does not matter: as long as the first is G, and the second is U, Valine will be added next to the growing protein.

Looking too hard at the three and seven here might dazzle us with numerology - for all the useful harmonies and memory tricks one can find in such things. It would be easy enough to see the middle carbon as baby Jesus in the crib, the two end carbons as Mary and Joseph, three hydrogens on one side as shepherds, three on the other as the Magi, and the Angel-of-the-Gloria as that middle hydrogen. But that's just shadows.

Let us not push too hard on the analogies. Let us see J3's Valine as just a larger form, an extension in kind, of J2's Alanine and a predecessor to J4 and J5 (which we shall consider soon).

No, let us not even bother with the image, whether it be statues or pictures, or words, even those as touching as GKC's: "the hands that had made the sun and stars were too small to reach the huge heads of the cattle".

Rather, let us simply come to the crib as we are right now, sitting at our computers, and think of the God Who came to live with us, as poor as we are, as dirty as we are, as uncaring as we are, as nasty as we are - not to condemn, not even to chide.

Just to love.... and there He is, asleep.

Waiting for us to love Him, even just a little.

December 06, 2006 (J2) Alanine

Alanine - the Visitation (J2)

December 06, 2006

As St. Luke tells us, the merely days-pregant Mary "set off in haste" to go see Elizabeth. Now that we have considered the special beginning AUG symbol, and its other use for the rather special sulfur-containing Methionine with its single code, we too set off into the main collection of amino acids. Again and again we'll see those same three: a single hydrogen, the -NH₂ amine, and the -COOH carboxylic acid, all linked to the central carbon, and see how the "side chain" can vary in its complexity. We'll also see variations in the number of codes which are used by the mRNA to select that amino acid to be added to the growing protein.

Today's amino acid is Alanine, which is one of the hydrophobic group. That is, its side chain will tend to avoid the surrounding water in the living cell, and try to stay clustered together with other such hydrophobic groups. This clustering suggests the strongly common character of the Joyful mysteries, in which our Lord is one-celled (J1) or unborn (J2) or newborn (J3) or a week old (J4) or 12 years old (J5) - yet all of which are rather more closely related to each other than to those of the Public Ministry in the L mysteries, the Passion in the S mysteries, or the Glorious Life of the G mysteries.



Alanine (abbreviated Ala or A)
RNA Codes:


G C G
G C U
G C A
G C C


Note that all four of the codes for Alanine begin with GC - it does not matter what the third base is. This is part of the superlative design of the protective machinery of the genetic code: that third base is completely immune to mutation. (We'll see more about this as we go.)

The side chain of Alanine is the very simple -CH₃ methyl group. (Only one other amino acid is simpler, and I will explain its symbolism in due course.) Here, we might take the simplicity of the four atoms in the methyl group as a suggestion of the four simple characters in our mystery:
(1) Elizabeth's few words acknowledge the divine maternity even at this extremely early stage
(2) John leaps for joy at the nearness of the Redemption
(3) The great paradox that Mary who magnifies the infinite God comes to serve her relative during a pregancy in "advanced age".
(4) Our unborn Lord Who "humbled Himself to come among us as a Man" - He submits to being "knit together" just as we were (see Psalm 139(138):13). Indeed, this simplicity is a strong reminder of our unborn Lord hidden within Mary: as He proceeds through the various stages of prenatal life, yes, as simple as that... multiple cells, the blastomeres (or morula), the blastula, the division into "germ layers" and finally the beginnings of the various organs and systems. How profound to ponder that it was during that time - while Mary was with Elizabeth during those three months - that the Sacred Heart first began to beat - the rhythm of Divine Love entered the kosmos.

As we think on the simplicity of Alanine and of the Visitation, may we proclaim as Elizabeth did, jump for joy as John did, serve as Mary did, and love with all our heart as Jesus did.

December 05, 2006 (J1) Methionine

Methionine - the Annunciation (J1)

December 05, 2006

In my comments on the beginning of life, which I made at the beginning of this Advent commentary, I told you that we would see the AUG code again. Today is that day. When I wrote that beginning, I was still weighing various possible arrangements of my topics, but now, after a number of struggles, I have resolved to use the simplest one. Probably there is another which is more "poetic" but arranging it takes time which I do not have - so I have to simplify where I can. Hence, we'll start with the Joyful, and proceed, with exceptions to handle ... er.... the exceptions, as you shall see.

So, today we consider the First Joyful Mystery, the Annunciation. It is the beginning of a new story, in which a spirit spoke to a woman - yes, so similar to the beginning of the old story, where a spirit spoke to a woman. But in the new story, the woman was obedient; so much so, that her "yes" (which is a "positive") became a "sign of contradiction". In a mathematics beyond the norms of worldly "logic", this positive would "negate" the original negation. (A lot of theology can be found even in the simple + plus-sign of addition!) Many other writers, theologians, mystics, and poets, have written about this mystery, examining its parallels and allusions. But, because of my design, I shall examine an amino acid, and try to find a poetic suggestion there.

Two days ago, I explained that the code "AUG" is the "initiation code" which begins the translation from the mRNA into protein. I told you that we would see the code again, and this is why: the AUG code has a different meaning when it is not the beginning. That is, when AUG appears as an actual code, inside the "open reading frame" of the mRNA which is the actual blueprint for the protein being built. There, it stands for the amino acid called Methionine:



Methionine (abbreviated Met or M)
RNA Code:

A U G

(Yes, there is only one code for Methionine.)

The selection of Methionine to symbolize J1 was made simply because J1 is the start of the mysteries, and AUG signifies the start. Indeed, the parallel is rich, because AUG is both start and Met. Should the start code for some protein be damaged, the ribosome may simply begin at the next AUG, which really ought to be a Met - so the protein will be somewhat shorter than it should be. Also, even though the liturgical year of the Church begins with the first Sunday of Advent, the Annunciation is celebrated on March 25 (nine months before Christmas!) Actually, there may be innumerable repetitions of J1, whether one is saying the Rosary, or the three-times-a-day Angelus prayer; this hints at the Church's use of liturgical repetition of feasts to hint at eternity. (There's much more to say about that, but I defer it to another time.)

Now, Methionine, like several other amino acids, is called "hydrophobic" because it will tend to "stay away" from water. You have seen this if you have ever made salad dressing: unlike vinegar, olive oil (or whatever kind you like) will "stay away" from water, and bead together; you have to do tricks if you want them to join, as in mayonnaise! Hence I felt something poetic as I took Methionine and four other hydrophobic amino acids to denote the five Joyful mysteries, which begin the re-binding of Man to God. Remember the prayer at the offertory? We'll hear more about this later, but I will quote it now:

By the mingling of this water and wine, may we come to share in the divinity of Christ Who humbled Himself to share in our humanity.

But unlike the other four amino acids which I shall talk about shortly, Methionine is different. In fact, among the twenty, only two contain an atom of sulfur (the brown S in the above diagram). At the heart of J1, is Mary's fiat - her "let it be done", by which she said "Yes" to God. This "S" is a token for that "Yes". (Indeed, the other amino acid with an "S" will therefore stand for the other "Yes" which was said; you can puzzle that out, or you can wait, and you will find out more about it soon enough.)

A priest friend told me of a beautiful Vietnamese hymn to Mary in which the chorus (loosely translated) is "Dear Mary teach us always to say Yes (to God)." Let us always turn to her, who always said Yes to God, and who was the first to know Christ, to help us know Him more, and to always say Yes as she did.

December 04, 2006 (G3) Histidine

Histidine - the Descent of the Holy Spirit (G3)

December 04, 2006

In his masterwork, The Pirotechnia, the great 16th century metallurgist Vannoccio Biringuccio pointed out that when one embarks on any difficult task one always ought to begin by invoking the assistance of God - otherwise he might be invoking the demons! Indeed, it has long been the design of the Church to begin any difficult task (like ordaining priests, confirming young adults, or electing the Pope!) by invoking the assistance of the Holy Spirit. This is nothing more than the miniature version of the Great Novena which the Apostles, together with Mary, spent in prayer, and which ended in the sending of the Holy Spirit, which we still do every year in the nine days after the Ascension.

Yesterday, as you well know, I did as Alice heard the King instruct the White Rabbit: to "begin with the beginning". However, another part of my design requires that I recall the first four Glorious Mysteries on the Sundays of Advent - but I cannot quite do that, since I've already explained the beginning yesterday, and I will have to explain the end on Christmas Eve (I've given away no secrets; you'll still be surprised!) So I will just use the standard trick which the Church uses, and deal with things as soon as I can. (If you don't know about that, I'll explain some other time.)

So, today we turn to the Holy Spirit and ask that He guide us to a deeper grasp of the mysteries - in particular by pondering the mystery of Pentecost, when He came in the form of tongues of fire upon the Apostles and Mary. This great mystery is the completion of the Paschal feast (Pentecost means fiftieth) - the "week of weeks" or "great octave" which comes fifty days after the Passover and Easter. To symbolize this mystery, I have selected the amino acid called Histidine:



Histidine (abbreviated His, or H)

RNA Codes:

C A U
C A C

Since this is the first amino acid we are examining, I must point out a few things now - some of which will be much more clear in a day or two once you have seen some more. Every amino acid has one central carbon atom. (In the diagram, it's the second one in from the left.) Carbon has four bonds, and in an amino acid, that carbon is attached to four different things:

1. a hydrogen atom (below the central carbon)
2. an NH₂ group. This is called an "amine", and so the whole is called an amino acid. (It sticks up, like a Y, from the central carbon.)
3. a COOH group. This is called a "carboxylic acid" and so the whole is called an amino acid They are rather weak acids, not at all like the kind in car batteries or used in industry. (The carboxyl carbon is the leftmost C; one oxygen (O) is connected with a double bond, and the other O has the H attached.)
4. Something else, which is called the "side chain" and which gives the "proper name" to the specific amino acid being considered.

Also: since this is the first one of the Glorious Mysteries I am considering, I will first explain the symbolism I am using. Five of the 20 amino acids have side chains which contain "ring structures" where the atoms are connected in the form of a loop. Like the wedding ring which has no end, this shape hints at the mysteries which lie on "other side" of our Lord's death.

According to one reference, Histidine is "positively charged, but only weakly at neutral pH". Here, we are reminded of the weakness of the Apostles, waiting in the Upper Room. Its "side chain" (the part which is unique to this amino acid), is made of a methyl - the CH₂ group - and a ring of five atoms: carbon, nitrogen, carbon, nitrogen, carbon. Because of the double bonds, there are only three more hydrogens in the ring, thus amounting to 11 atoms, suggesting the Eleven before the selection of Matthias. There is a very distinct Marian aspect (see Acts 1:14) to this mystery; as we shall see when we examine the amino acids for the two later Glorious Mysteries, the ring of Histidine contains nitrogen. (Of course every amino acid has a nitrogen, but I refer to the "side-chain" part.)

As I look at the diagram, I must tell you that am not very happy with it. The ring of the five atoms might look much more like a pentagon. But I wrote that program some time ago, and as I see now, I never bothered to fix certain things. (And I do not have time to fix it now!) It is not quite so nice for my first diagram, but it is good for me to admit my shortcomings Indeed, it struck me that there are times when I have not been as careful in my meditating on the Mysteries as I should be.

Yet, the Holy Spirit assists us in our weakness, and helps us to pray as we ought... (See Romans 8:26)

December 03, 2006

Advent 2006 - the short, 22-day form

December 03, 2006

Today marks the start of the shortest form of Advent: three weeks and the Fourth Sunday, which is also Christmas Eve - a mere 22 days. Since last year was the longest form, I spent those 28 days giving my own little Jesse tree symbols with comment/meditation thoughts on each one. For this year, given both the number and my rather busy situation, I will take advantage of a parallel I hinted at in my lengthy discussion on the Rosary and the Luminous Mysteries, which you can find by means of my index.

Now, you are surely wondering how I must do math, if I am going to take 22 days to explain the 20 mysteries. But the analogy is actually stronger with 22. You see, there are indeed 20 mysteries, five in each of four sets. There are also, in molecular biology, 20 amino acids coded by 61 various three-letter mRNA codes, which could be organized into a variety of arrangements, paralleling those mysteries, and two other special signals as well, totalling 22 - so I can talk about one each day.

Please note I am not proposing any "model" or "mystical analogy" here - well, maybe a little mystical, though perhaps poetic is a better word. Since I am interested in LOTS of different things, I tend to make associations among them, just as most people do. And why not? If David can say "The Lord is my shepherd" and John can write "In the beginning was the Word" there may be something more to be learned from taking the words of Jesus "I am the Way and the Truth and the Life" according to a modern, molecular biology point of view.

So. Today we begin Advent. Much can be said about other forms of beginnings: New Year's Day, ignition keys, the downbeat of a conductor. But how does life begin?

There are many answers, each of which harmonizes with the others - but depending on how, or where (that is, at what point in the process) one considers that "beginning". But since I have mentioned a model based on the 20 amino acids, there is a very clear starting point to be found in the code of mRNA, which is short for "messenger" RNA. (How funny, since the Annunciation started with a messenger too, though we usually use Greek and call him an angel.)

The mRMA is a "working copy" for the "shop floor" which is taken from the "permanent records" in the DNA archive. What does it look like? Here is a sample:

AUGGAGGAGCCGCAGUCAGAUCCUAGCGUCGAGCCCCCUCUGAGUCAGGAAACA UUUUCAGACCUAUGGAAACUACUUCCUGAAAACAACGUUCUGUCCCCCUUGCCG UCCCAAGCAAUGGAUGAUUUGAUGCUGUCCCCGGACGAUAUUGAACAAUGGUUC ACUGAAGACCCAGGUCCAGAUGAAGCUCCCAGAAUGCCAGAGGCUGCUCCCCCC GUGGCCCCUGCACCAGCAGCUCCUACACCGGCGGCCCCUGCACCAGCCCCCUCC UGGCCCCUGUCAUCUUCUGUCCCUUCCCAGAAAACCUACCAGGGCAGCUACGGU UUCCGUCUGGGCUUCUUGCAUUCUGGGACAGCCAAGUCUGUGACUUGCACGUAC UCCCCUGCCCUCAACAAGAUGUUUUGCCAACUGGCCAAGACCUGCCCUGUGCAG CUGUGGGUUGAUUCCACACCCCCGCCCGGCACCCGCGUCCGCGCCAUGGCCAUC UACAAGCAGUCACAGCACAUGACGGAGGUUGUGAGGCGCUGCCCCCACCAUGAG CGCUGCUCAGAUAGCGAUGGUCUGGCCCCUCCUCAGCAUCUUAUCCGAGUGGAA GGAAAUUUGCGUGUGGAGUAUUUGGAUGACAGAAACACUUUUCGACAUAGUGUG GUGGUGCCCUAUGAGCCGCCUGAGGUUGGCUCUGACUGUACCACCAUCCACUAC AACUACAUGUGUAACAGUUCCUGCAUGGGCGGCAUGAACCGGAGGCCCAUCCUC ACCAUCAUCACACUGGAAGACUCCAGUGGUAAUCUACUGGGACGGAACAGCUUU GAGGUGCGUGUUUGUGCCUGUCCUGGGAGAGACCGGCGCACAGAGGAAGAGAAU CUCCGCAAGAAAGGGGAGCCUCACCACGAGCUGCCCCCAGGGAGCACUAAGCGA GCACUGCCCAACAACACCAGCUCCUCUCCCCAGCCAAAGAAGAAACCACUGGAU GGAGAAUAUUUCACCCUUCAGAUCCGUGGGCGUGAGCGCUUCGAGAUGUUCCGA GAGCUGAAUGAGGCCUUGGAACUCAAGGAUGCCCAGGCUGGGAAGGAGCCAGGG GGGAGCAGGGCUCACUCCAGCCACCUGA

It's a long string made out of the four RNA letters: A, C, G, U, usually from one to several hundred letters in length. But somewhere near the "start" of that mRNA string will be found a three-letter pattern, which we write in shorthand as "AUG" but can be translated, "begin here". What begins? The making of proteins. The poetry in that is the mRNA (spelled with an alphabet of only four "letters") is a "word", and the proteins are our "flesh"... so this is about "words made flesh".

Yes, technically, there somewhat more than just the "AUG" start symbol - before that comes a kind of "preamble" which indicates the "coding area" - that's the part that actually says something, just like a book has a cover and a title page. This is because the ribosome - that is the "machine" which does the actual work - has to be "set up" and prepared for its work. But the real start of the work, the very first letter of the word to be built from the mRNA code, is always this "initiation symbol". The ribosome machine, after all, is rather like many other machines. It is not "wilful" or subject to "doing its own thing". In that fashion, it is more like a car, which has to have the key put into the ignition in order to start. The ribosome has to "find" those three letters, and only those three letters, as they are, next to each other - no translation, no funny business - or it never begins! It just won't start. And it will keep looking for them, scanning step by step, until it finds them, or it runs out of the mRNA blueprint.

Another interesting thing about this startup is that the ribosome does something kind of different, just to be able to start. It uses what are called "initiation factors" to get everything just right. Once it has started, those parts are disconnected, and no longer used - almost like the starter in the car, which doesn't play a further role once the engine is actually running. These factors are important because the ones which humans use are very different from the ones used by bacteria - and the famous "antibiotics" take advantage of this difference! They are chemicals which are made to "look" like the real ones - counterfeits - they fit in OK but don't do the work. So we humans can take them when we're sick, and they don't hurt us, but deep inside the bacteria, they just slow down, because they are no longer doing the work of making proteins.

This may seem all very technical, and I have left out lots of details. Perhaps I have only made a hint or two at the "poetry" or take-off points where all this detail links over to the Rosary. But if you simply think of how the preamble of the rosary is made, with the Apostles Creed, an Our Father (Lord's Prayer), three Hail Marys, and a Glory be - a kind of miniature of the whole set of all the mysteries - well, that might be enough for a start.

But there is one more thing I must tell you about this very important AUG code. You are going to see it again. Because it has two uses, one of which you now know is the very beginning of things. You will hear more about its other use sometime in the next 20 days...

An Explanation

An Explanation

[A note from Dr. Thursday: This poem appears by special permission from the Editor-in-Chief of Something Good To Read.]

On the other side of the hill near where I live
They're dumping tons and tons of coal into a sieve,
And there it is divided, like the Master's flocks,
Saved is all the chosen coal, reject all the rocks.

In a massive grinder, the coal with fearsome whine
Is broken down into a dust so super-fine
That it flows like water: ah, this wondrous black blood
Enlivens our city with hidden pulsing flood.

Those tons and tons of coal dust now are mixed with air
Forced through pipes towards a mighty furnace, where
The coal, like fluid, from four fountains gushes out:
There, all boxed in, a cyclone-fire spins about.

Within that blazing chimney and through every wall
Is sent a river, heated by that fireball
And changed to supersteam; no warmth escapes the plan
Which by water makes the fire revolve a fan.

This fan is large and strong, so smooth and free to spin
But it turns more than itself when the steam comes in.
Upon that spinning shaft wire has been braided
As if coppersmiths by hairdressers were aided.

Unseen, but all around this spinning copper braid
Is set a wall of force - a wall by magnets made.
When a copper braid spins in a magnetic place,
Unseen things (of amber named) are compelled to race.

The copper braid full of electrons in motion,
Gliding past brushes which grasp it with devotion,
Sixty times in a second each passes on charge,
To transform that power, it must both wane and enlarge.

Copper strands cross the mountains, dive under the street
And enter into my room where I decide to complete
The path from the coal, the furnace, the stream,
Immersed in magnets, compelled by the steam,
The copper braid spinning, sixty Hertz is the scheme,
Enacted and planned by a vast human team;
Electrons in motion, back and forth they must scream:
The switch is on; how does my lamp beam.

(March 4, 1998)