December 03, 2006

Advent 2006 - the short, 22-day form

December 03, 2006

Today marks the start of the shortest form of Advent: three weeks and the Fourth Sunday, which is also Christmas Eve - a mere 22 days. Since last year was the longest form, I spent those 28 days giving my own little Jesse tree symbols with comment/meditation thoughts on each one. For this year, given both the number and my rather busy situation, I will take advantage of a parallel I hinted at in my lengthy discussion on the Rosary and the Luminous Mysteries, which you can find by means of my index.

Now, you are surely wondering how I must do math, if I am going to take 22 days to explain the 20 mysteries. But the analogy is actually stronger with 22. You see, there are indeed 20 mysteries, five in each of four sets. There are also, in molecular biology, 20 amino acids coded by 61 various three-letter mRNA codes, which could be organized into a variety of arrangements, paralleling those mysteries, and two other special signals as well, totalling 22 - so I can talk about one each day.

Please note I am not proposing any "model" or "mystical analogy" here - well, maybe a little mystical, though perhaps poetic is a better word. Since I am interested in LOTS of different things, I tend to make associations among them, just as most people do. And why not? If David can say "The Lord is my shepherd" and John can write "In the beginning was the Word" there may be something more to be learned from taking the words of Jesus "I am the Way and the Truth and the Life" according to a modern, molecular biology point of view.

So. Today we begin Advent. Much can be said about other forms of beginnings: New Year's Day, ignition keys, the downbeat of a conductor. But how does life begin?

There are many answers, each of which harmonizes with the others - but depending on how, or where (that is, at what point in the process) one considers that "beginning". But since I have mentioned a model based on the 20 amino acids, there is a very clear starting point to be found in the code of mRNA, which is short for "messenger" RNA. (How funny, since the Annunciation started with a messenger too, though we usually use Greek and call him an angel.)

The mRMA is a "working copy" for the "shop floor" which is taken from the "permanent records" in the DNA archive. What does it look like? Here is a sample:

AUGGAGGAGCCGCAGUCAGAUCCUAGCGUCGAGCCCCCUCUGAGUCAGGAAACA UUUUCAGACCUAUGGAAACUACUUCCUGAAAACAACGUUCUGUCCCCCUUGCCG UCCCAAGCAAUGGAUGAUUUGAUGCUGUCCCCGGACGAUAUUGAACAAUGGUUC ACUGAAGACCCAGGUCCAGAUGAAGCUCCCAGAAUGCCAGAGGCUGCUCCCCCC GUGGCCCCUGCACCAGCAGCUCCUACACCGGCGGCCCCUGCACCAGCCCCCUCC UGGCCCCUGUCAUCUUCUGUCCCUUCCCAGAAAACCUACCAGGGCAGCUACGGU UUCCGUCUGGGCUUCUUGCAUUCUGGGACAGCCAAGUCUGUGACUUGCACGUAC UCCCCUGCCCUCAACAAGAUGUUUUGCCAACUGGCCAAGACCUGCCCUGUGCAG CUGUGGGUUGAUUCCACACCCCCGCCCGGCACCCGCGUCCGCGCCAUGGCCAUC UACAAGCAGUCACAGCACAUGACGGAGGUUGUGAGGCGCUGCCCCCACCAUGAG CGCUGCUCAGAUAGCGAUGGUCUGGCCCCUCCUCAGCAUCUUAUCCGAGUGGAA GGAAAUUUGCGUGUGGAGUAUUUGGAUGACAGAAACACUUUUCGACAUAGUGUG GUGGUGCCCUAUGAGCCGCCUGAGGUUGGCUCUGACUGUACCACCAUCCACUAC AACUACAUGUGUAACAGUUCCUGCAUGGGCGGCAUGAACCGGAGGCCCAUCCUC ACCAUCAUCACACUGGAAGACUCCAGUGGUAAUCUACUGGGACGGAACAGCUUU GAGGUGCGUGUUUGUGCCUGUCCUGGGAGAGACCGGCGCACAGAGGAAGAGAAU CUCCGCAAGAAAGGGGAGCCUCACCACGAGCUGCCCCCAGGGAGCACUAAGCGA GCACUGCCCAACAACACCAGCUCCUCUCCCCAGCCAAAGAAGAAACCACUGGAU GGAGAAUAUUUCACCCUUCAGAUCCGUGGGCGUGAGCGCUUCGAGAUGUUCCGA GAGCUGAAUGAGGCCUUGGAACUCAAGGAUGCCCAGGCUGGGAAGGAGCCAGGG GGGAGCAGGGCUCACUCCAGCCACCUGA

It's a long string made out of the four RNA letters: A, C, G, U, usually from one to several hundred letters in length. But somewhere near the "start" of that mRNA string will be found a three-letter pattern, which we write in shorthand as "AUG" but can be translated, "begin here". What begins? The making of proteins. The poetry in that is the mRNA (spelled with an alphabet of only four "letters") is a "word", and the proteins are our "flesh"... so this is about "words made flesh".

Yes, technically, there somewhat more than just the "AUG" start symbol - before that comes a kind of "preamble" which indicates the "coding area" - that's the part that actually says something, just like a book has a cover and a title page. This is because the ribosome - that is the "machine" which does the actual work - has to be "set up" and prepared for its work. But the real start of the work, the very first letter of the word to be built from the mRNA code, is always this "initiation symbol". The ribosome machine, after all, is rather like many other machines. It is not "wilful" or subject to "doing its own thing". In that fashion, it is more like a car, which has to have the key put into the ignition in order to start. The ribosome has to "find" those three letters, and only those three letters, as they are, next to each other - no translation, no funny business - or it never begins! It just won't start. And it will keep looking for them, scanning step by step, until it finds them, or it runs out of the mRNA blueprint.

Another interesting thing about this startup is that the ribosome does something kind of different, just to be able to start. It uses what are called "initiation factors" to get everything just right. Once it has started, those parts are disconnected, and no longer used - almost like the starter in the car, which doesn't play a further role once the engine is actually running. These factors are important because the ones which humans use are very different from the ones used by bacteria - and the famous "antibiotics" take advantage of this difference! They are chemicals which are made to "look" like the real ones - counterfeits - they fit in OK but don't do the work. So we humans can take them when we're sick, and they don't hurt us, but deep inside the bacteria, they just slow down, because they are no longer doing the work of making proteins.

This may seem all very technical, and I have left out lots of details. Perhaps I have only made a hint or two at the "poetry" or take-off points where all this detail links over to the Rosary. But if you simply think of how the preamble of the rosary is made, with the Apostles Creed, an Our Father (Lord's Prayer), three Hail Marys, and a Glory be - a kind of miniature of the whole set of all the mysteries - well, that might be enough for a start.

But there is one more thing I must tell you about this very important AUG code. You are going to see it again. Because it has two uses, one of which you now know is the very beginning of things. You will hear more about its other use sometime in the next 20 days...